View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8132_high_40 (Length: 212)
Name: NF8132_high_40
Description: NF8132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8132_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 119 - 199
Target Start/End: Complemental strand, 18312785 - 18312705
Alignment:
| Q |
119 |
aatttagaaccgcaagtttatgtatgatctactataataattctgtttgccattgagaaaacacaaactgtgttaggattt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18312785 |
aatttagaaccgcaagtttatgtatgatctactataataattctgtttgccattgagaaaacacaaattgtgttaggattt |
18312705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 4 - 157
Target Start/End: Complemental strand, 2783407 - 2783244
Alignment:
| Q |
4 |
ggcaatatctaatatcagacaaaatcctcaatcattgtaaggaggccatgttattatcacatcaaatagaa------------gtgtcaatttaatcact |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||| |||||||||||| ||| |
|
|
| T |
2783407 |
ggcaatatctaagatcagacaaaatcctcaatcagtgtaaagaggccatgttatcatcacatcaaatagaaatttaacacatggtgtcaatttaagtact |
2783308 |
T |
|
| Q |
92 |
atcattaatgcaagtggggcaatctccaatttagaaccgcaagtttatgtatgatctactataata |
157 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
2783307 |
ataattaatgcaagtggggcaatcttcaatttagaaccgcaagatta--tatgttctactataata |
2783244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 199
Target Start/End: Complemental strand, 2783185 - 2783146
Alignment:
| Q |
160 |
tctgtttgccattgagaaaacacaaactgtgttaggattt |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2783185 |
tctgtttgtcattgagaaaacacaaactgtgttaggattt |
2783146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University