View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8132_low_28 (Length: 305)
Name: NF8132_low_28
Description: NF8132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8132_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 85 - 293
Target Start/End: Complemental strand, 43188280 - 43188082
Alignment:
| Q |
85 |
ggatttcagaagtggtggaatggaagctagatccctatatccatccggattccaaataggaacaaatgatgctaacatgttttattgaacgctaactgat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43188280 |
ggatttcagaagtggtggaatggaagctagatccctatatccatccggattccaaataggaacaaatgatgctaacatgttttattgaacgccaactgat |
43188181 |
T |
|
| Q |
185 |
gaaagaatcaccaaaaaatacacaaaatccagcagttgagcaccgagatataagacaagtagctcagtaagagtcactaaatgctttctagttgtaacaa |
284 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43188180 |
gaaagaatcacca----------aaaatccagcagttgagcaccgagatataagacaagtagctcaataagagtcactaaatgctttctagttgtaacaa |
43188091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University