View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8132_low_37 (Length: 250)
Name: NF8132_low_37
Description: NF8132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8132_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 48394848 - 48395090
Alignment:
| Q |
1 |
ttctcaacgtagaaagagctctccgtggcatacgtaagttttccataatcttgttgttattatatacgtaaaattgcattc----------aattgaatt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
48394848 |
ttctcaacgtagaaagagctctccgtggcatacgtaagttttccataatcttgttgttattatatacctaaaattgcattgcattgcattgaattgaatt |
48394947 |
T |
 |
| Q |
91 |
gatgaagatatggtttagaatgcagctattacggatgcagatcattatggtagacttggcttaccaaaaggatgtccatatgacatggtcagaaacattt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48394948 |
gatgaagatatggtttagaatgcagctattacagatgcagatcattatggtagacttggcttaccaaaaggatgtccatatgacatggtcagaaacattt |
48395047 |
T |
 |
| Q |
191 |
tatatcggatttaattcatatataccttcgtctatgatgaaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48395048 |
tatatcggatttaattcatatataccttcgtcgatgatgaaaa |
48395090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 87 - 116
Target Start/End: Original strand, 48414116 - 48414145
Alignment:
| Q |
87 |
aattgatgaagatatggtttagaatgcagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48414116 |
aattgatgaagatatggtttagaatgcagc |
48414145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University