View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8133_low_3 (Length: 348)
Name: NF8133_low_3
Description: NF8133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8133_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 52579470 - 52579159
Alignment:
| Q |
1 |
aattatttatactccgaggttgtccttgtcttgtcacccatatagagtacacaaattataaagaattatttaaaggattttgtttagactaatactttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| | || |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52579470 |
aattatttatactccgaggttgtccttgtcttgtcacccatat-gagtagataagttataaagaattatttaaaggattttgtttggactaatactttac |
52579372 |
T |
 |
| Q |
101 |
ttgcatgcattgcggatccagcaataactaatcggtttcatttgtccctctgtaccgaaataaatataaagtttcttgtcaattactaccgatagagaga |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579371 |
ttgcaagcattgcggatccagcaataactaatcggtttcatttgtccctctgtaccgaaataaatataaagtttcttgtcaattactaccgatagagaga |
52579272 |
T |
 |
| Q |
201 |
cgataaggatcatggtaatattgatattgatttgataacgaaataagatgggatttgattcaattcgtgacgtggtttcatctgcattcaacaaatggac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579271 |
cgataaggatcatggtaatattgatattgattt-----------------ggatttgattcaattcgtgacgtggtttcatctgcattcaacaaatggac |
52579189 |
T |
 |
| Q |
301 |
aagtgttttgcatgaatcacttgttaccat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52579188 |
aagtgttttgcatgaatcacttgttaccat |
52579159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University