View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8133_low_7 (Length: 246)
Name: NF8133_low_7
Description: NF8133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8133_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 1414253 - 1414021
Alignment:
| Q |
1 |
ctaatatataaacaacgacaattttgtcaaaacgtaaatttgacataatgtgtttcatgctgtatttacggatcatgctagaatgctttgggacaccatg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414253 |
ctaatatataaacaatgacaattttgtcaaaacgtaaatttgacataatgtgtttcatgctgtatttacggatcatgctagaatgctttgggacaccatg |
1414154 |
T |
|
| Q |
101 |
cttttggatcaaacacttgtgagnnnnnnntgcctaacaatagctttgagacacgtgttggataaaaagacagagagatgggattgacacaaacattaga |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414153 |
cttttggatcaaacacttgtgagaaaaaaatgcctaacaatagctttgagacacgtgttggataaaaagacagagagatgggattgacacaaacattaga |
1414054 |
T |
|
| Q |
201 |
caatggtaatcttttttacggtactaatgatgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1414053 |
caatggtaatcttttttacggtactaatgatgt |
1414021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University