View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8134_low_6 (Length: 254)
Name: NF8134_low_6
Description: NF8134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8134_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 254
Target Start/End: Complemental strand, 44695038 - 44694804
Alignment:
| Q |
20 |
gtaccagactctgggaaggtaccattactttgtacttacctatatactatgtatagtatcatctttaatagttttagtgnnnnnnngttcattgcatctg |
119 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44695038 |
gtaccagactccgggaaggtaccattactttgtacttacttatatactatgtaaagtatcatctttaatagttttagtgtttttttgttcattgcatctg |
44694939 |
T |
 |
| Q |
120 |
agtatttcctgaaatcacaatgaattcataggtggaactacagtacttgaatagattcactgggattactggatgcattggattattaggaaacgaagaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694938 |
agtatttcctgaaatcacaatgaattcataggtggaactacagtacttgaatagattcactgggattactggatgcattggattattaggaaacgaagaa |
44694839 |
T |
 |
| Q |
220 |
ggagcatatgaccctgttgtaaaattatcaggcct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694838 |
ggagcatatgaccctgttgtaaaattatcaggcct |
44694804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University