View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8136_high_10 (Length: 222)
Name: NF8136_high_10
Description: NF8136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8136_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 29 - 194
Target Start/End: Complemental strand, 28654272 - 28654110
Alignment:
| Q |
29 |
gttagatggatcacatgattgtgataaatatatgattttctaatgataagaatctcgtgttggcttgataacctactttgcggttaagtgaaaatatcga |
128 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28654272 |
gttagacggatcacatgattgtgacaaatatatgattttctaatgataagaatctcgtgttggcttgataacctactttgcgtttaagtgaaaatatcga |
28654173 |
T |
 |
| Q |
129 |
acatctacattgaaaagaaatgatcatgaagtcctacaaaattataaagatatacacttgcaccca |
194 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28654172 |
acatctacattgaaaagaaatg---atgaagtcctacaaaattataaagatatatacttgcaccca |
28654110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University