View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8136_high_11 (Length: 208)
Name: NF8136_high_11
Description: NF8136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8136_high_11 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 34977413 - 34977210
Alignment:
| Q |
1 |
agaatggtttgaagaagaagcttgttaaggaaggtgaagggtgggaaactcctgataatggagatcaagttgaaggtaattaattaataatcaatcaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34977413 |
agaatggtttgaagaagaagcttgttaaggaaggtgaagggtgggaaactcctgataatggagatcaagttgaaggtaattaat----aatcaatcaaat |
34977318 |
T |
 |
| Q |
101 |
ttaaattacatttcacatctttctgttatgaaactgaattggttagtaatgtaatgttgattttgattgtgtctttttgtagttcattatactggaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34977317 |
ttaaattacatttcacatctttctcttatgaaactgaattggttagtaatgtaatgttgattttgattgtgtctttttgtagttcattatactggaattt |
34977218 |
T |
 |
| Q |
201 |
tgcttgat |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
34977217 |
tgcttgat |
34977210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 3497546 - 3497496
Alignment:
| Q |
6 |
ggtttgaagaagaagcttgttaaggaaggtgaagggtgggaaactcctgat |
56 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||| ||||| ||||||||| |
|
|
| T |
3497546 |
ggtttgaagaagaagcttctcaaagaaggtgaaggttgggatactcctgat |
3497496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University