View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8136_low_6 (Length: 303)
Name: NF8136_low_6
Description: NF8136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8136_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 69 - 174
Target Start/End: Original strand, 45212396 - 45212497
Alignment:
| Q |
69 |
tttaatcataaagctagaatatgggtactgtgattgactcccattttttagccctcactgccataatcacagtaagtacatattctcaattctcaattcc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
45212396 |
tttaatcataaagctagaatatgggtactgtgattgactcccattttttagccctcactgccataatcaccgtaag----tattctcaattctcaattcc |
45212491 |
T |
 |
| Q |
169 |
aattcc |
174 |
Q |
| |
|
|||||| |
|
|
| T |
45212492 |
aattcc |
45212497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 210 - 284
Target Start/End: Original strand, 45212542 - 45212616
Alignment:
| Q |
210 |
atcaatatcaatttgcagtttgcctatcaacttatgtttttcatcatcaccgctcttctcaaattcgacaaggtc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45212542 |
atcaatatcaatttgcagtttgcctatcaacttctgtttttcatcatcaccgctcttctcaaattcgacaaggtc |
45212616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University