View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8137_high_8 (Length: 289)
Name: NF8137_high_8
Description: NF8137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8137_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 33 - 273
Target Start/End: Complemental strand, 32901583 - 32901352
Alignment:
| Q |
33 |
ctaaagcaaatgcaacaaatgctgaaaaacaccagaaccaccaccgctccaacggcgattccgatgacagttcctgttgatatacttgatgatgacggtg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32901583 |
ctaaagcaaatgcaacaaatgctgaaaaacaccagaaccaccaccgctccaacggcgattccgatgacagttcctgttgatatacttgatgaagacggtg |
32901484 |
T |
 |
| Q |
133 |
gtgaaggtggcggtggagttttggaggatggtggtgatggactgtcatcagagcttggtggagtccgggaaggtggagacggggtagtgcctcctccggt |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32901483 |
gtgaaggtggcggcggagttttggaggatggtggtgatggactgtcatcagagcttggtggagtccgggaaggtggagacggagtagtgcctcctccg-- |
32901386 |
T |
 |
| Q |
233 |
cggtggcgacggtggtgatatcgccggagttgttggtggcg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32901385 |
-------gacggtggtgatatcgccggagttgttggtggcg |
32901352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University