View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8137_low_17 (Length: 228)
Name: NF8137_low_17
Description: NF8137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8137_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 8022627 - 8022844
Alignment:
| Q |
1 |
cttctccggcccactccatcgaagacgatgtgcaacaatttcccatatatatttgtcttttggtgtgcgcggattttctccaacaatggtctagccaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022627 |
cttctccggcccactccatcgaagatgatgtgcaacaatttcccatatatatttgtcttttggtgtgcgcggattttctccaacaatggtctagccaatt |
8022726 |
T |
 |
| Q |
101 |
tacgcactagctaannnnnnngaacgaaccaacgaggcnnnnnnnnnnnnnnctataatcgtcgaagaaacctaatagctgcagaatcagtcatcaggag |
200 |
Q |
| |
|
|||||||||||||| |||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022727 |
tacgcactagctaatttttttgaacaaaccaacgaagc-aaaaaaaaaaaaactataatcgtcgaagaaacctaatagctgcagaatcagtcatcaggag |
8022825 |
T |
 |
| Q |
201 |
gaacaaacaaaaaagtagg |
219 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
8022826 |
ggacaaacaaaaaagtagg |
8022844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University