View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8137_low_7 (Length: 313)
Name: NF8137_low_7
Description: NF8137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8137_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 24 - 298
Target Start/End: Complemental strand, 32730376 - 32730102
Alignment:
| Q |
24 |
cgtgaagcatagaatgtgagacctacatgcagagagggagtgggggttgtgtcccaaaataataacagtgactttagattcgttaatttaagaattgtga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730376 |
cgtgaagcatagaatgtgagacctacatgcagagaggaagtgggggttgtgtcccaaaataataacagtgactttagattcgttaatttaagaattgtga |
32730277 |
T |
|
| Q |
124 |
ttggctatgggatttacttttgagccaagaagagtactcgtgggtggggcataaagtataactcctctgtctcaaccttactggcccatttgtatcaccc |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730276 |
ttggctattggatttacttttgagccaagaagagtactcgtgggtggggcataaagtataactcctctgtctcaaccttactggcccatttgtatcaccc |
32730177 |
T |
|
| Q |
224 |
ttccattcttataatcaatatactatttctctgccacttttcaagtgatgcttcatcattggggagcatattcat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730176 |
ttccattcttataatcaatatactatttatctgccacttttcaagtgatgcttcatcattggggagcatattcat |
32730102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University