View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8137_low_9 (Length: 292)
Name: NF8137_low_9
Description: NF8137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8137_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 144 - 274
Target Start/End: Original strand, 38865166 - 38865296
Alignment:
| Q |
144 |
tcagattgctgatgagtgaaaaagctcagaatgtaaagcttggtagttgtttggttggaaaaggatatgatatggatgaggaatgtgcagaggtgaaaac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38865166 |
tcagattgctgatgagtgaaaaagctcagaatgtaaagcttggtagttgtttggttggaaaaggatatgatatgggtgaggaatgtgcagaggtgaaaac |
38865265 |
T |
 |
| Q |
244 |
aatcaaaataggaggggccgaggggggactt |
274 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |
|
|
| T |
38865266 |
aatcaaaataggaggggccaaggggggactt |
38865296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 100
Target Start/End: Original strand, 38865050 - 38865133
Alignment:
| Q |
17 |
aagcacataccaagaagaggcgtgattcgaccttgtattagtaagggactatgggaagattcaccagagataattatctctttt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38865050 |
aagcacataccaagaagaggcatgattcgaccttgtattagtaagggactatgggaagattcaccagagataattatctctttt |
38865133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 38808400 - 38808318
Alignment:
| Q |
17 |
aagcacataccaagaagaggcgtgattcgaccttgtattagtaagggactatgggaagattcaccagagataattatctcttt |
99 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38808400 |
aagcaaataccaagaagaggcgtgattcgaccttgtattagtaagggtctatgggaagattcaacagagataattatctcttt |
38808318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 150 - 259
Target Start/End: Complemental strand, 38808288 - 38808184
Alignment:
| Q |
150 |
tgctgatgagtgaaaaagctcagaatgtaaagcttggtagttgtttggttggaaaaggatatgatatggatgaggaatgtgcagaggtgaaaacaatcaa |
249 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||| | | ||||| ||||||||||||| |||||||||||| ||| |
|
|
| T |
38808288 |
tgctgatgagtgaaaatccacagaatgtaaagcttggtagttgtttggttggaaagg-----gttatgggtgaggaatgtgcaaaggtgaaaacaaacaa |
38808194 |
T |
 |
| Q |
250 |
aataggaggg |
259 |
Q |
| |
|
|||||||||| |
|
|
| T |
38808193 |
aataggaggg |
38808184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University