View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8139_high_3 (Length: 336)
Name: NF8139_high_3
Description: NF8139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8139_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 58 - 319
Target Start/End: Complemental strand, 220393 - 220131
Alignment:
| Q |
58 |
cactttgcttcatatatgaccctgcattcctaacagttgctccaatttgctttaaagccgtgtttgactgcatgtgtaaattgaaacaaatgaagttata |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
220393 |
cactttgcttcatatatgaccctgcattcctaacagttgctccaatttgctttaaagccgtgtttgactgcatgtgtaaattgaaacaaatgaagttata |
220294 |
T |
 |
| Q |
158 |
tatacgtcacattactttctatatatagattgtgcaaaagat-nnnnnnnnnttgtgcaaaatcaaaatatgtcgtgtaaaactctaaacctcatgtcca |
256 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
220293 |
tatacgtcacattaatttctatatatagattgtgcaaaagataaaaaaaaaattgtgcaaaatcaaaatatgtcgtgtaaaactctaaacctcatgtcca |
220194 |
T |
 |
| Q |
257 |
tcacaatatttttgtttaccatatgaatcaaatctttaacctccttatcacttcactccctaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
220193 |
tcacaatatttttgtttaccatatgaatcaaatctttaacctccttatcacttcactctctaa |
220131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University