View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8139_low_6 (Length: 227)
Name: NF8139_low_6
Description: NF8139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8139_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 34187333 - 34187109
Alignment:
| Q |
1 |
cattcaccaaatgcataactccattaatcaaaagtttgacaacacccttcccattgaccttaagagcataattatttcctaattttacctcatcacaaaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187333 |
cattcacaaaatgcataactccattaatcaaaagtttgacaacacccttcccattgaccttaagagcataattatttcctaattttacctcatcacaaaa |
34187234 |
T |
 |
| Q |
101 |
agaagcatcaagtgaagaaaaccagtcctttctacctgtcatatggttgctacagcctgaatcgatgaaccacatgtcttgtgtatttgattctccatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187233 |
agaagcatcaagtgaagaaaaccagtcctttctacctgtcatatggttgctgcagcctgaatcgatgaaccacatgtcttgtgtatttgattctccatct |
34187134 |
T |
 |
| Q |
201 |
gatgaaagttgtgccatgagtagca |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34187133 |
gatgaaagttgtgccatgagtagca |
34187109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University