View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8140_low_3 (Length: 300)
Name: NF8140_low_3
Description: NF8140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8140_low_3 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 287
Target Start/End: Original strand, 18802484 - 18802763
Alignment:
| Q |
8 |
ttggtgttatggttgagcgggtgtcccgtcctctaactcaattcttttactttgactgggatcatcgccttcgtcctgaaggtgaggcaaaaatttgttt |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
18802484 |
ttggtgttatggttgagcgggtgttccgtcctctaactcaattcttttacttcgattgggatcatcgcctctgtcttgaaggtgaggcaaaaatgtgttt |
18802583 |
T |
|
| Q |
108 |
cctcattagttgaatgcggtgtggagcggtatgcccacaagacgtgtgcaagtacctcgggccagcttccctttgcctcctctaatcttctcttcaaacc |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18802584 |
cctcattagttgaatgcggtgtggtgcggtatgcccacaagacgtgtggaagtacctcgggtcagcttccctttgcctcctctaatcttatcttcaaacc |
18802683 |
T |
|
| Q |
208 |
ttttaatatgaccctattggcagactccacctgtccattcatctgagggtgttctaccgaagtgaaatgtttcttgatgt |
287 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
18802684 |
ttttaatatgaccctattggcggactccacctacccgttcatctaagggtgttctaccgaagtgaaatgttgcttgatgt |
18802763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 114 - 287
Target Start/End: Complemental strand, 415540 - 415367
Alignment:
| Q |
114 |
tagttgaatgcggtgtggagcggtatgcccacaagacgtgtgcaagtacctcgggccagcttccctttgcctcctctaatcttctcttcaaaccttttaa |
213 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||| || | ||||||||||||||| ||||||||||||| ||||||||||| ||| | | |
|
|
| T |
415540 |
tagttgaatgcggtgtggtgcggtacgcccacaagacgtgtgggcgttcttcgggccagcttcccattgcctcctctaaccttctcttcaatcctctcag |
415441 |
T |
|
| Q |
214 |
tatgaccctattggcagactccacctgtccattcatctgagggtgttctaccgaagtgaaatgtttcttgatgt |
287 |
Q |
| |
|
|| | ||| ||||| ||||||| ||||| ||| |||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
415440 |
taccatcctcttggcggactccagctgtctgttcgtctgagagtgttctaccgaagtgaagtgttgcttgatgt |
415367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University