View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8141_low_6 (Length: 261)
Name: NF8141_low_6
Description: NF8141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8141_low_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 44 - 261
Target Start/End: Complemental strand, 28421950 - 28421731
Alignment:
| Q |
44 |
tcctgtttattactggatgatgctatgatttatgagtctagctagggactcttgggtgttgaattttattataatggtttcaaata--acacataaagga |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28421950 |
tcctgtttattactggatgatgctatgatttatgagtctagctagggactcttgggtgttgaattttattataatggtttcaaatataacacataaagga |
28421851 |
T |
 |
| Q |
142 |
gaattctttaattgatgttctgaaatggatttgtcttcaagtgtttggatgatattagattcctatcaccccactattgaatatcttcagagaacgagat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28421850 |
gaattctttaattgatgttctgaaatggatttgtcttcaagtgtttggatgatattagattcctatcaccccactattgaatatcttcagagaacgagat |
28421751 |
T |
 |
| Q |
242 |
ctttcactcccttgtccttt |
261 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28421750 |
ctttcactcccttgtccttt |
28421731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University