View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8141_low_8 (Length: 241)
Name: NF8141_low_8
Description: NF8141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8141_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 25038361 - 25038173
Alignment:
| Q |
19 |
agcatgtggtttatttggatttttgaggtagtggggtggtgtgtgtatgcagcagaatatagcaaatattttttgagttttgagagaagctagcaaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25038361 |
agcatgtggtttatttggatttttgaggtagtggggtggtgtgtgtatgcagcagaatatagcaaatattttttgagttttgagagaagctagcaaattt |
25038262 |
T |
|
| Q |
119 |
gcacttgcagtcttcaaggcatagagaggatggcaaacttttttgcttttattttaggatcttgttaatttgtattataatctatgaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25038261 |
gcacttgcagtcttcaaggcatagagaggatggcaaacttttttgcttttattttaggatcttgttaacttgtattataatctatgaag |
25038173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University