View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8142_high_10 (Length: 274)
Name: NF8142_high_10
Description: NF8142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8142_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 3018428 - 3018634
Alignment:
| Q |
20 |
cccaagccatccacataagagtgcaaatcccaaggtgaacacaactagcgcaatatcttgattatgtgttaaatcggtgagatttgggtatgcctgctcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3018428 |
cccaagccatccacataagagtgcaaatcccaaggtgaaca--actagcataatatcttgattatgtgttaaatcagtgagatttgggtatgcctgctcc |
3018525 |
T |
 |
| Q |
120 |
gattggtctaaagacaacaattgaatacataagatggtattttgccatttcgcatccatacattgcatgtcagcaagaggatgctcatatcctgattcgt |
219 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3018526 |
gactggtctaaagacaacaattgaatacataagatggtattttgccatttcgcatccatacattgcatgtcagcaggaggatgctcatatcctgattcgt |
3018625 |
T |
 |
| Q |
220 |
caatttgcc |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
3018626 |
caatttgcc |
3018634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University