View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8142_high_14 (Length: 229)
Name: NF8142_high_14
Description: NF8142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8142_high_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 32110499 - 32110271
Alignment:
| Q |
1 |
tcaattttctgtatcagtagtgcctaccactacctcattgacacaagttccagcaataacattcaacaacactgcacaacaactgataccgaactctgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32110499 |
tcaattttctgtatcagtagtgcctaccactacctcattgacacaagttcctgcaataacattcaacaacattgcacaacaactgataccgaactctgtt |
32110400 |
T |
 |
| Q |
101 |
gagtattcttctaactcggaacaaagattacagaagtcttcttctgtgaatgttgacaaggctaatgacgatggctacaactggaggaagtatggacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32110399 |
gagtattcttctaactcggaacaaagattacagaagtcttcttttgtgaatgttgacaaggctaatgacgacggctacaactggaggaagtatggacaaa |
32110300 |
T |
 |
| Q |
201 |
aacaagtgaaaggttgcgagtttcctcga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32110299 |
aacaagtgaaaggttgcgagtttcctcga |
32110271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 229
Target Start/End: Complemental strand, 18876392 - 18876333
Alignment:
| Q |
170 |
gatggctacaactggaggaagtatggacaaaaacaagtgaaaggttgcgagtttcctcga |
229 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
18876392 |
gatggctacaactggaggaaatacggacagaaacaggtgaaaggtagcgagtttcctcga |
18876333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University