View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8142_low_15 (Length: 231)
Name: NF8142_low_15
Description: NF8142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8142_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 30183496 - 30183394
Alignment:
| Q |
1 |
ataggtttaaatcaattaatttagagtagaatttgttgttgcaaaatataagcaatcaccgacatcaagttcagtagttcactataaatgtacttttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183496 |
ataggtttaaatcaattaatttagtgtagaatttgttgttgcaaaatataagcaatcaccgacatcaagttcagtagttcactataaatgtacttttaac |
30183397 |
T |
|
| Q |
101 |
gaa |
103 |
Q |
| |
|
||| |
|
|
| T |
30183396 |
gaa |
30183394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 136 - 212
Target Start/End: Complemental strand, 30183367 - 30183291
Alignment:
| Q |
136 |
cacacgcggacttttacttggacaagaggatcattcaagtttgaagtaacctaatttctttgttgaatggtggttct |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183367 |
cacacgcggacttttactaggacaagaggatcattcaagtttgaagtaacctaatttctttgttgaatggtggttct |
30183291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University