View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8142_low_7 (Length: 340)
Name: NF8142_low_7
Description: NF8142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8142_low_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 72 - 340
Target Start/End: Complemental strand, 32483534 - 32483266
Alignment:
| Q |
72 |
gctgatagatatgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483534 |
gctgatagatatgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtc |
32483435 |
T |
 |
| Q |
172 |
atcagtatttggctatctttttcagagaattcctctaaaccaaaagattctctctttgtttttgctttcctttatttcaccactcactctcttaaccata |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483434 |
atcagtatttggctatctttttcagagaattcctctaaaccaaaagattctctctttgtatttgctttcctttatttcaccactcactctcttaaccata |
32483335 |
T |
 |
| Q |
272 |
acactgaaaagggtcaatcacggaaactgctagtgcttctgattaatacaccttacaccttatgtcaca |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483334 |
acactgaaaagggtcaatcacggaaactgctagtgcttctgattaatacaccttacaccttatgtcaca |
32483266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University