View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_high_18 (Length: 360)
Name: NF8143_high_18
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 108 - 208
Target Start/End: Original strand, 9622310 - 9622410
Alignment:
| Q |
108 |
tccaagtttatttaccaaaagctattaggataaaagctttaaatttaccaagaacggatagtggttcatttacatatgaatcaaattcatcaaatggtag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9622310 |
tccaagtttatttaccaaaagctattaggataaaagctttaaatttaccaagaacggatagtggttcatttacatatgaatcaaattcatcaaatggtag |
9622409 |
T |
 |
| Q |
208 |
c |
208 |
Q |
| |
|
| |
|
|
| T |
9622410 |
c |
9622410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 275 - 341
Target Start/End: Original strand, 9622474 - 9622540
Alignment:
| Q |
275 |
gaggttggtgagaagggagaaaatgacggatttgggcatgactatgactatgacttagtcaacgttg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9622474 |
gaggttggtgagaagggagaaaatgacggatttgggcatgactatgactatgacttagtcaacgttg |
9622540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University