View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_high_29 (Length: 290)
Name: NF8143_high_29
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 38826384 - 38826122
Alignment:
| Q |
1 |
tatatggtcattggtagatgttttatattat---aattaacannnnnnngtaagcaacagatatttgcaatgccagtgtttgacatgattgaaaccctct |
97 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38826384 |
tatatggtcattggaagatgttttatattattataattaacatttttttgtaagcaacagatatttgcaatgccagtgtttgacatgattgaaaccctct |
38826285 |
T |
 |
| Q |
98 |
tggttaagcaaatggaatttgcacctacatttgcacttcgattatcagttcgcacactatatgttggtatgtctacttgttgcactagatcaatgaaagc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38826284 |
tggttaagcaaatggaatttgcacctacatttgcactccgattatcagttcgcacactatatgttggtatgtctacttgttgcactagatcaatgaaagc |
38826185 |
T |
 |
| Q |
198 |
ttcatccgttagttttttgttaactttttgatcttattttgtagcgttgaccatgctcattgc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38826184 |
ttcatccgttagttttttgttaactttttgatcttattttgtagcgttgaccatgttcattgc |
38826122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University