View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_high_36 (Length: 270)
Name: NF8143_high_36
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 260
Target Start/End: Original strand, 567195 - 567438
Alignment:
| Q |
17 |
aattgttcccacaggcagagctagcaacagcattaagagactatgttggtagagagacacctttgtatcatgctcaaaggttgtcagagcattacaaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
567195 |
aattgttcccacaggcagagctagcaacagcattaagagactatgttggtagagagacacctttgtatcatgctcaaaggttgtcagagcattacaaaag |
567294 |
T |
 |
| Q |
117 |
caagaatggtgggaaagggcctgaaatatacttaaaaagagaggatctcaaccacactggctctcacaagatgaacaatgctcttgcacaagctatgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
567295 |
caagaatggtgggaaagggcctgaaatatacttaaaaagagaggatctcaaccacactggctctcacaagatgaacaatgctcttgcacaagctatgatt |
567394 |
T |
 |
| Q |
217 |
gccaagcgcatcggtctaaaaagtgtcgttacggccacaggttc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
567395 |
gccaagcgcatcggtctaaaaagtgtcgttacggccaccggttc |
567438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University