View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_high_39 (Length: 250)
Name: NF8143_high_39
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 42935123 - 42935370
Alignment:
| Q |
1 |
tgtgatgatgaggagaagtttgttgagtatttaatttagatttattatgtttatgtatctacttttgatgctattttactttgatttgaatccaannnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42935123 |
tgtgatgatgaggagaagtttgttgagtatttaatttagatttattatgtttatgtatctacttttgatgctattttactttgatttgagtccaattttt |
42935222 |
T |
 |
| Q |
101 |
nngtgaacataatgtgttattcaatatatgtatgagattgtgatttctataaaaacacactnnnnnnnttaataaataaactggcagcatgtgattgtcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
42935223 |
ttgtgaacataatgtgttattcaatatatgtatgagattgtgatttctataaaaacacactaaaaaaattaataaataaactggtagcatgtgattgtca |
42935322 |
T |
 |
| Q |
201 |
tgttatattatgcagcaacaactgtatctacctttcttgaagaatttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935323 |
tgttatattatgcagcaacaactgtatctacctttcttgaagaatttt |
42935370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University