View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_high_41 (Length: 250)
Name: NF8143_high_41
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 40941054 - 40940810
Alignment:
| Q |
1 |
ccttccagaagtgtcttcaggagtttcactgcttcagcggag---tcacttgacgtatcaattttggaaaaactttcttttacaactgatgaagctcttc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40941054 |
ccttccagaagtgtcttcaggagtttcaccgcttcagcggaggagtcacttgacgtatcaattttggaaaaactttcttttacaactgatgaagctcttc |
40940955 |
T |
|
| Q |
98 |
ccaaattatccgcaacatcaagtaaactctttgcaaaattctacagcacatttaaataaatcagcnnnnnnnttatgagtaagttatttgggacaaaaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40940954 |
ccaaattatccgcaacatcaagtaaactctttgcgaaattctacagcacatttaaataaatcagcaaaaaaattatgagtaagttatttgggacaaaaat |
40940855 |
T |
|
| Q |
198 |
gttcaaactttgacctgtatagcaaatttcgtttaattctctgct |
242 |
Q |
| |
|
||||||| ||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
40940854 |
gttcaaattttgacctgtatagcgaatttccttgaattctctgct |
40940810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 55 - 142
Target Start/End: Complemental strand, 21505207 - 21505120
Alignment:
| Q |
55 |
tcaattttggaaaaactttcttttacaactgatgaagctcttcccaaattatccgcaacatcaagtaaactctttgcaaaattctaca |
142 |
Q |
| |
|
|||||||| |||||||| || ||||||||||| ||||||||||||||||| || |||||||||||||||||||| |||||| |||||| |
|
|
| T |
21505207 |
tcaatttttgaaaaactgtcctttacaactgaagaagctcttcccaaattgtcagcaacatcaagtaaactcttggcaaaactctaca |
21505120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University