View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_high_46 (Length: 241)
Name: NF8143_high_46
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 39570950 - 39570722
Alignment:
| Q |
1 |
tgttgtttcttgagactgctttgttgttggttgcaattgatacttgctccagatctttgttcttgttgnnnnnnnn-----acaaagagtatgaattcac |
95 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39570950 |
tgttgtttcttgagactggtttgttgttggttgcaattgatacttgctccaaatctttgttcttgttgtttttttttttttacaaagagtatgaattcac |
39570851 |
T |
 |
| Q |
96 |
aataagtgacaaccacgtgtaccaaatttgacatcttgaagatggaaacaatttttgttcaacataagtgtatgaaagcattgaaacatgggacgataat |
195 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39570850 |
aataaatgagaaccacgtgtaccaaatttgacatcttggagatggaaacaatttttgttcaacataagtgtatgtaagcattgaaacatgggacgataat |
39570751 |
T |
 |
| Q |
196 |
gtcagtcaaccgagcataatcaaagaaga |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
39570750 |
gtcagacaaccgagcataatcaaagaaga |
39570722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University