View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_low_29 (Length: 322)
Name: NF8143_low_29
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 30 - 291
Target Start/End: Complemental strand, 11461292 - 11461031
Alignment:
| Q |
30 |
gagcttcaatgtccttcatagtccatcttgcagagagtcagtcctaataaatccataaacaattaactaacaaaccacaatcacataaattaacaaacta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11461292 |
gagcttcaatgtccttcatagtccatcttgcagagagtcagtcctaataaatccataaacaattaactaacaaaccacaatcacataaattaacaaacta |
11461193 |
T |
 |
| Q |
130 |
tcaagtaacctaaaactctggatcaattgcagtagaaataattctaatcacgaaagagatttgaagaagatatataacttgtttcaatatttctatcaaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11461192 |
tcaagtaacctaaaactctggatcaattgcagtggaaataattctaatcacgaaagaaatttgaagaagatatataacttgtttcaatatttctatcaaa |
11461093 |
T |
 |
| Q |
230 |
cgcttggtgagaaaatattaaagaatacaatttctcattattggaacactctttcaagttag |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11461092 |
cgcttggtgagaaaatattaaagaatacaatttctcattattggaacactctttcaagttag |
11461031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University