View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8143_low_39 (Length: 283)

Name: NF8143_low_39
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8143_low_39
NF8143_low_39
[»] chr4 (2 HSPs)
chr4 (153-235)||(49766980-49767062)
chr4 (1-54)||(49766825-49766881)
[»] chr2 (1 HSPs)
chr2 (155-201)||(14137707-14137753)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 153 - 235
Target Start/End: Original strand, 49766980 - 49767062
Alignment:
Q  153 cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctgtatggatgatcaatgcattgcatg 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  49766980 cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctatatggatgatcaatgcattgcatg 49767062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 49766825 - 49766881
Alignment:
Q  1 agttgtagctgatacagtgttgatg---gaagaagaagaaggacaatgacgagtagt 54  Q
    |||||| ||||||||||||||||||   |||||||||||||||||||||||||||||    
T  49766825 agttgttgctgatacagtgttgatggaagaagaagaagaaggacaatgacgagtagt 49766881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 14137753 - 14137707
Alignment:
Q  155 agtttaccaagtttttcttgaagacaaaaagcacagatcccaccagg 201  Q
    ||||||||||||||||||||||||||||||||||| || ||||||||    
T  14137753 agtttaccaagtttttcttgaagacaaaaagcacatataccaccagg 14137707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University