View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_low_42 (Length: 274)
Name: NF8143_low_42
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 54436321 - 54436075
Alignment:
| Q |
19 |
tgatattgacatggctgttttcttgcttccctttccatcctttttcaaattgaatttcttgttgccaacttaacatattgcttgatgttattctcatcag |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54436321 |
tgatattgacatggctgctttcttgcttccctttccatcctttttcaaattgaatttcttgttgccaacttaacatattgcttgatgttattctcatcag |
54436222 |
T |
|
| Q |
119 |
ttctgctttatggcttggccatttttatgttctaatgttgctcttagaatagtaaacctatgtagtcatggctcacgatt--cacatacaaattaatcta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54436221 |
ttctgctttatggcttggccatttttatgttctaatgttgctcttagaatagtaaacttatgtagtcatggctcacgattcacacatacaaattaatcta |
54436122 |
T |
|
| Q |
217 |
taataatgctggaagcatatgttgttgctcagttccactcctctctg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54436121 |
taataatgctggaagcatatgttgttgctcagttccactcctctctg |
54436075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University