View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_low_54 (Length: 244)
Name: NF8143_low_54
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 86 - 180
Target Start/End: Original strand, 32737556 - 32737649
Alignment:
| Q |
86 |
gtctgtatgtactgcaatatgtcagtgcctgaccatgtctgtctcaatctctaaaaattgttggtttctttgttcgttgagttccaatattttca |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32737556 |
gtctgtatgtactgcaatatgtcattgcctgaccatgtctgtcacaatctctaaaaa-tgttggtttctttgatcgttgagttccaatattttca |
32737649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 192 - 236
Target Start/End: Original strand, 32737680 - 32737724
Alignment:
| Q |
192 |
ccctcatcactttgccagttgccactgcacagcatcagaacacca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32737680 |
ccctcatcactttgccagttgccactgcacagtatcagaacacca |
32737724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University