View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_low_65 (Length: 216)
Name: NF8143_low_65
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 45457405 - 45457591
Alignment:
| Q |
14 |
atgaaatgaggggatgaattataa---taataataataagctgtccgtccacagtgacagatcaaggagatacaatataattgattcacattaacgtgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45457405 |
atgaaatgaggggatgaattataataataataataataagctgtccgtccacagtgacagatcaaggtgatacaatataattgattcacattaacgtgaa |
45457504 |
T |
|
| Q |
111 |
gatcactatgtatgtctgaatgaatgcacatgttgtttgtgattgactgtgagtcaatatcataacatatgtgttgatattgatatc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45457505 |
gatcactatgtatgtctgaatgaatgcacatgttgtttgtgattgactgtgagtcaatatcataacatatgtgttgatattgatatc |
45457591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University