View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8143_low_67 (Length: 202)

Name: NF8143_low_67
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8143_low_67
NF8143_low_67
[»] chr5 (1 HSPs)
chr5 (20-190)||(43113871-43114041)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 43113871 - 43114041
Alignment:
20 atgatctacttcagatccttcagaagttgacaaatgatcttcttggctttcactttctgatccatcgatattaacttcttcttgtgcttcattttcttca 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
43113871 atgatctacttcagatccttcagaagttgacaaatgatcttcttggctttcactttctgatccatcaatattaacttcttcttgtgcttcattttcttca 43113970  T
120 ttacttttctcatcatctgaattcagaaacttttcttctactaatttatcaacatttacttttctctgctt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
43113971 ttacttttctcatcatctgaattcagaaacttttcttctactaatttatcaacatttacttttctttgctt 43114041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University