View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_low_67 (Length: 202)
Name: NF8143_low_67
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 43113871 - 43114041
Alignment:
| Q |
20 |
atgatctacttcagatccttcagaagttgacaaatgatcttcttggctttcactttctgatccatcgatattaacttcttcttgtgcttcattttcttca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43113871 |
atgatctacttcagatccttcagaagttgacaaatgatcttcttggctttcactttctgatccatcaatattaacttcttcttgtgcttcattttcttca |
43113970 |
T |
 |
| Q |
120 |
ttacttttctcatcatctgaattcagaaacttttcttctactaatttatcaacatttacttttctctgctt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43113971 |
ttacttttctcatcatctgaattcagaaacttttcttctactaatttatcaacatttacttttctttgctt |
43114041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University