View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8143_low_68 (Length: 201)
Name: NF8143_low_68
Description: NF8143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8143_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 69 - 184
Target Start/End: Original strand, 10312331 - 10312445
Alignment:
| Q |
69 |
ctcacacatttatttgcatacatagtcatagaaattattgatgtatagcttgagcaaggtacattcataccttcaagacatgtacatatttacgtatttt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10312331 |
ctcacacatttatttgcatacatagtcatagaaattattgatgtatagcttgagcaaggtacattcataccttcaagacatgtacatatttacg-atttt |
10312429 |
T |
 |
| Q |
169 |
gtgtgttatgtgtatg |
184 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10312430 |
gtgtgttatgtgtatg |
10312445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University