View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8144_low_8 (Length: 297)
Name: NF8144_low_8
Description: NF8144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8144_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 20 - 172
Target Start/End: Complemental strand, 42467796 - 42467644
Alignment:
| Q |
20 |
acatcttgcacaaacaaatttgtatctctatcctttggcttatgcgtgtagatcaggacacaggtcctgggttttcaaattctattatcagccaagtaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467796 |
acatcttgcacaaacaaatttgtatctctatcctttggtttatgcgtgtagatcaggacacaggtcctgggttttcaaattctattatcagccaagtaaa |
42467697 |
T |
|
| Q |
120 |
gatgactggcggtaatggtctcctcaacacactcccaattcttgatagcaaga |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
42467696 |
gatgactggcggtaatggtctcctcaacacactcccaattcttgctatcaaga |
42467644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 207 - 281
Target Start/End: Complemental strand, 42467639 - 42467564
Alignment:
| Q |
207 |
ctttggttatcaagaaactctt-gatgtggtcaataatggagttcaagaactctctgcaaatgtaaatgaagcaaa |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467639 |
ctttggttatcaagaaactcttagatgtggtcaataatggagttcaagaactctctgcaaatgtaaatgaagcaaa |
42467564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 221
Target Start/End: Complemental strand, 27126314 - 27126224
Alignment:
| Q |
131 |
gtaatggtctcctcaacacactcccaattcttgatagcaagagttgggaaagatggcataaacagatgaaagcactctttggttatcaaga |
221 |
Q |
| |
|
|||||||||||| ||| ||| || || |||||||| |||||| |||||||||| |||||||| |||||||||| || ||||| | |||||| |
|
|
| T |
27126314 |
gtaatggtctccccaatacattctcagttcttgatggcaagaattgggaaagacggcataaagagatgaaagctctatttggctttcaaga |
27126224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University