View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8146_high_12 (Length: 231)
Name: NF8146_high_12
Description: NF8146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8146_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 5432706 - 5432582
Alignment:
| Q |
17 |
tgaaaccagttttaatgcaatgagtatcgacactaagcctactgcagctgttattgctaatagtttggataggaaaaagtggagagaagatgagacgaat |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
5432706 |
tgaaaccagttttaatgcgatgagtatcgacactaagcctactgtagctgttattgctaatactttggataggaaaatgtggagagaaggtgagacgaat |
5432607 |
T |
 |
| Q |
117 |
gtacttgtgttcgatcttggcagtg |
141 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
5432606 |
gtacttgtgttcgatcttggtagtg |
5432582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 52 - 136
Target Start/End: Original strand, 5445649 - 5445733
Alignment:
| Q |
52 |
agcctactgcagctgttattgctaatagtttggataggaaaaagtggagagaagatgagacgaatgtacttgtgttcgatcttgg |
136 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||| | ||||| ||||||||||| ||||| |||||| |||||||| |||||||| |
|
|
| T |
5445649 |
agcctactgcagctgctattgcttatggtttggacaagaaaatgtggagagaaggtgagaagaatgtgcttgtgtttgatcttgg |
5445733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University