View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8146_high_12 (Length: 231)

Name: NF8146_high_12
Description: NF8146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8146_high_12
NF8146_high_12
[»] chr2 (2 HSPs)
chr2 (17-141)||(5432582-5432706)
chr2 (52-136)||(5445649-5445733)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 5432706 - 5432582
Alignment:
17 tgaaaccagttttaatgcaatgagtatcgacactaagcctactgcagctgttattgctaatagtttggataggaaaaagtggagagaagatgagacgaat 116  Q
    |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||    
5432706 tgaaaccagttttaatgcgatgagtatcgacactaagcctactgtagctgttattgctaatactttggataggaaaatgtggagagaaggtgagacgaat 5432607  T
117 gtacttgtgttcgatcttggcagtg 141  Q
    |||||||||||||||||||| ||||    
5432606 gtacttgtgttcgatcttggtagtg 5432582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 52 - 136
Target Start/End: Original strand, 5445649 - 5445733
Alignment:
52 agcctactgcagctgttattgctaatagtttggataggaaaaagtggagagaagatgagacgaatgtacttgtgttcgatcttgg 136  Q
    ||||||||||||||| ||||||| || ||||||| | ||||| ||||||||||| ||||| |||||| |||||||| ||||||||    
5445649 agcctactgcagctgctattgcttatggtttggacaagaaaatgtggagagaaggtgagaagaatgtgcttgtgtttgatcttgg 5445733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University