View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8146_low_17 (Length: 205)
Name: NF8146_low_17
Description: NF8146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8146_low_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 23 - 205
Target Start/End: Original strand, 43866731 - 43866913
Alignment:
| Q |
23 |
gcgatttcaagattacactattcagtcagacttgagaaagtcaaagcttagcaaatttatttggcaatccaaaaataatagtggagctaggaattgacat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43866731 |
gcgatttcaagattacactattcagtcagacttgagaaagtcaaagcttagcaaatttatttggcaatccaaaaataatagtggagctaggaattgacat |
43866830 |
T |
 |
| Q |
123 |
gtagattaccgatttgagttgaccaaaacggtgcggatcattgaagaactgagccattttagcagtcctaggattatgaaccc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43866831 |
gtagattaccgatttgagttgaccaaaacggtgcggatcattgaaaaactgtgccattttagcagtcctaggattatgaaccc |
43866913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University