View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8146_low_4 (Length: 439)
Name: NF8146_low_4
Description: NF8146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8146_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 4e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 16912212 - 16912061
Alignment:
| Q |
15 |
actattaataaaccttgaccatagctatttaatatcttaatgaaaacaaaacatcatggattgttgttgtccaactgtatagccaacataacagcctttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
16912212 |
actattaataaaccttgaccatagctatttaatatcttgatgaaaacaaaacatcatggattgtcgttgaccaactgtatagccaacataacagcctttg |
16912113 |
T |
|
| Q |
115 |
tattcatgttgcaatcaactccaattatgttagccccaaacatcaatatccc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16912112 |
tattcatgttgcaatcaactccaattatgttagccccaaacatcaatatccc |
16912061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 357
Target Start/End: Original strand, 50789209 - 50789297
Alignment:
| Q |
269 |
cttccaaggtttgaaccaacaaaattcaattttgcagcacaatatataaagtacaaaataaatttaaaccacactccattgataatctt |
357 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||| |||| ||| |||||||||||||||| || ||||||| |||||| || ||||| |
|
|
| T |
50789209 |
cttccaaggtttgaaacaacaaagttcagtttttcagctcaacgcgtaaagtacaaaataaaattcaaccacaatccattcatcatctt |
50789297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University