View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8146_low_6 (Length: 327)
Name: NF8146_low_6
Description: NF8146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8146_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 15057936 - 15057675
Alignment:
| Q |
18 |
ataagcagcatagcatacacattgacacagacgcagggatgcctggctgtaacgaacttcacccggctcttcgcgatgccttcgacaacatcgcatgcaa |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15057936 |
ataagcagcatagcatacacgttgacacagacgcagggatgcctggctgcaacgaacttcacccggctcttcgcgatgcctgcgacaacatcgcatgcaa |
15057837 |
T |
 |
| Q |
118 |
ggtcactcgcctctccaaagccgagatatctcgtctcaccgaagacgagctatctcgtctcatggaggatgagttatctcacctctccaaggacgagatg |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15057836 |
ggtcactcgcctctccaaagccgatatatctcgtctcaccgaagacgagctatctcgtctcatggaggatgagttatctcacctctccaaggacgagatg |
15057737 |
T |
 |
| Q |
218 |
aatagcctgatgaatagccttatcaaagccgagttttctcactgctttgctctcatggaaggcctgctatctct |
291 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15057736 |
aata------------gccttatcgaagccgagttttctcactgctttgctctcatggaaggcctgctatctct |
15057675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University