View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8147_low_7 (Length: 250)
Name: NF8147_low_7
Description: NF8147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8147_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 27126540 - 27126773
Alignment:
| Q |
16 |
attataaacaccattttacttttttcgcttcattatttgatctatattacaaatcaaacacgtagttattcaacgaatgtaaaatataannnnnnnncct |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||| |||| || |
|
|
| T |
27126540 |
attataaacaacattttacttttttcgcttcattatttgatctatattataaatcagacacgtagttattcaaagaatgtaaaaaataattttt----ct |
27126635 |
T |
 |
| Q |
116 |
tattataattgagaccgaag----taattatcccatccaccaagtttttcaataaatatagcattcaaagaacaaatgagatgtttgtttctacatgacc |
211 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||| ||| | |
|
|
| T |
27126636 |
ccttataattgagatcgaagagagtaataatcccatccacaagttttttcaataaatatagcattcaaagaacaaatgagatgtttg-ttctacttgatc |
27126734 |
T |
 |
| Q |
212 |
acacccaccaacataattgttggaattgaggaacaccaa |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27126735 |
acacccacagacataattgttggaattgaggaacaccaa |
27126773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University