View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8148_low_10 (Length: 231)
Name: NF8148_low_10
Description: NF8148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8148_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 213
Target Start/End: Original strand, 48092056 - 48092257
Alignment:
| Q |
12 |
agcagagagtgagtggtcttattggacctgaacaaactcagagcttagtgaatggagcattagtactcatcactcttggaggaaatgattttgtgaataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48092056 |
agcagagagtgagtggtcttattggacctgaacaaactcagagcttagtgaatggagcattagtactcatcactcttggaggaaatgattttgtgaataa |
48092155 |
T |
 |
| Q |
112 |
ctattacttagtgccattctctgcaagatcacgccaatacaatttaccggattatgtcagatatataatatctgaatataagaagattttgagggtaaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48092156 |
ctattacttagtgccattctctgcaagatcacgccaatacaatttaccggattatgtcagatatataatatctgaatataagaagattttgagggtaaat |
48092255 |
T |
 |
| Q |
212 |
ta |
213 |
Q |
| |
|
|| |
|
|
| T |
48092256 |
ta |
48092257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University