View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8148_low_13 (Length: 218)
Name: NF8148_low_13
Description: NF8148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8148_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 4 - 118
Target Start/End: Original strand, 13885353 - 13885467
Alignment:
| Q |
4 |
cggcgtttgttgtttacaaatgaaagattcctcagaatcttcaacaatttcattatcttctacatgttttgctggtatcagagatcgttgggaatcacct |
103 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
13885353 |
cggcgtttgttgtttacaactgaaagattcctcagaatcttcaacaatttcattatcttctacatgttttgctgggatccgagattgttgggaatcaccc |
13885452 |
T |
|
| Q |
104 |
tgtgaattttcaatg |
118 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13885453 |
tgtgaattttcaatg |
13885467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University