View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8148_low_8 (Length: 239)
Name: NF8148_low_8
Description: NF8148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8148_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 48271646 - 48271865
Alignment:
| Q |
4 |
gttccttttaattacccttatttaatttactgtttccataatgataaaatcatgatactaacacaatcatatcaggaatctagacaagcgcagacgtctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271646 |
gttccttttaattacccttatttaatttactgtttccataatgataaaatcatgatactaacacaatcatatcaggaatctagacaagcgcagacgtctt |
48271745 |
T |
 |
| Q |
104 |
ttgattgcaatggatgtggcatttggaatggaatacctgcatggaaaaaacatagtacactttgacttgaaaagcgacaacttgcttgtgaatctccgag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271746 |
ttgattgcaatggatgtggcatttggaatggaatacctgcatggaaaaaacatagtacactttgacttgaaaagcgacaacttgcttgtgaatctccgag |
48271845 |
T |
 |
| Q |
204 |
atccacaccgcccaatatgc |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48271846 |
atccacaccgcccaatatgc |
48271865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 72 - 223
Target Start/End: Original strand, 25243382 - 25243533
Alignment:
| Q |
72 |
atatcaggaatctagacaagcgcagacgtcttttgattgcaatggatgtggcatttggaatggaatacctgcatggaaaaaacatagtacactttgactt |
171 |
Q |
| |
|
||||||||||||| |||||||||| |||||| ||||||||||||||||||| ||||| ||||| ||||| |||||||||||||| || ||||| ||||| |
|
|
| T |
25243382 |
atatcaggaatcttgacaagcgcaagcgtcttatgattgcaatggatgtggcctttggcatggagtacctccatggaaaaaacattgtgcacttcgactt |
25243481 |
T |
 |
| Q |
172 |
gaaaagcgacaacttgcttgtgaatctccgagatccacaccgcccaatatgc |
223 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25243482 |
gaaaagtgacaacttgcttgtgaatcttcgtgatccacaccgcccaatatgc |
25243533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University