View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8149_high_5 (Length: 317)
Name: NF8149_high_5
Description: NF8149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8149_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 52743991 - 52744292
Alignment:
| Q |
1 |
atatattcgttttgtttttatgtatgtagatgataattttctactttgcactcttgcataaatgcaaaaacaatttgtattaatgataggacatttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52743991 |
atatattcgttttgtttttatgtatgtagatgataattttctactttgcactcttgcataaatgcaaaaacaatttgtattaatgataggacatttattt |
52744090 |
T |
 |
| Q |
101 |
aggtatgaaaacgttagctaacatcacataccaaggagtaaaaggattatatcctctctagccaaaacacaagtagctagtgaaaac---caacaagtct |
197 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52744091 |
aggtatgaacacgttagctaacatcacataccaaggagtaaaaggattatatcctctctacccaaaacacaagtagctagtgaaaaccaacaacaagtct |
52744190 |
T |
 |
| Q |
198 |
tgtttgtttctttgataatttttgtacgggtggtatggaattgatttatcagatgcaacacgtacagaagaaaattcgtggcaatttcacaaacacgtct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52744191 |
tgtttgtttctttgataatttttgtacgggtggtatggaattgatttatcagatgcaacacgtacagaagaaaattcgtggcaatttcacaaacacgtct |
52744290 |
T |
 |
| Q |
298 |
at |
299 |
Q |
| |
|
|| |
|
|
| T |
52744291 |
at |
52744292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University