View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8149_low_10 (Length: 360)
Name: NF8149_low_10
Description: NF8149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8149_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 62 - 319
Target Start/End: Original strand, 5601581 - 5601844
Alignment:
| Q |
62 |
ttggtatgaataaagccaatgcatactatttagattacggctcatcttctggctgaatctatgtattgtgtttgtcttgaaaattcaagagttatagttt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5601581 |
ttggtatgaataaagccaatgcatactatttggattacggctcatcttctggctgaatctatgtattgtgtttgtcttgaaaattcaagagttatagttt |
5601680 |
T |
|
| Q |
162 |
attatatattgataaaattttcattattttgtactccaagttgtaagaagattggttgga---nnnnnnnnnngctttggcacgatcgttcgc---aatc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||| |||| |
|
|
| T |
5601681 |
attatatattgataaaattttcattattttgtactccaagttgtaagaagattggttggattttttttttctttctttggtatgatcgttcgcattaatc |
5601780 |
T |
|
| Q |
256 |
cacccattcgcatacagatattatggatccgaatcctatctcacaatatagttgtatgatagtg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5601781 |
cacccattcgcatacagatattatggatccgaatcctatctcacaatatagttgtatgatagtg |
5601844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 12 - 60
Target Start/End: Original strand, 5601510 - 5601558
Alignment:
| Q |
12 |
ataatactaaatgctatttatcccatttcttatcactttcatgacccta |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5601510 |
ataatactaaatgctatttatcccatttcttatcactttcatgacccta |
5601558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University