View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8152_low_1 (Length: 353)
Name: NF8152_low_1
Description: NF8152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8152_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 15 - 257
Target Start/End: Original strand, 26381265 - 26381507
Alignment:
| Q |
15 |
atcagaatggtggccgttttctgcagggtatggttgagaaaggaactgttgaggatatggaaatggtgtttaatggagttatagataatgttgtggagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26381265 |
atcagaatggtggccgttttctgcagggaatggttgagaaaggaactgttgaagatatggaaatggtgtttaatggagttattgataatgttgtggagct |
26381364 |
T |
 |
| Q |
115 |
tatgatggacccttttgggaattatcttgtgcaaaaattgctggagttttgtagggatgatcaaaggttgcagattgttcttatgttgactaaagttcct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26381365 |
tatgatggacccttttgggaattatcttgtgcaaaaattgctggagttttgtagggatgatcaaaggttgcagattgttcttatgttgactaaagttcct |
26381464 |
T |
 |
| Q |
215 |
ggtcagctagtcagaacctcattcaacacacatgggtaattta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26381465 |
ggtcagctagtcagaacctcattcaacacacatgggtaattta |
26381507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 149 - 255
Target Start/End: Original strand, 26386301 - 26386407
Alignment:
| Q |
149 |
aaattgctggagttttgtagggatgatcaaaggttgcagattgttcttatgttgactaaagttcctggtcagctagtcagaacctcattcaacacacatg |
248 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |||||| ||||||||||| || |||||||||||||||||| || |||||||||| |
|
|
| T |
26386301 |
aaattgctagagttttgtagtgatgatcaaaggttgcagattattcttaagttgactaaagagccgaatcagctagtcagaacctcgttaaacacacatg |
26386400 |
T |
 |
| Q |
249 |
ggtaatt |
255 |
Q |
| |
|
||||||| |
|
|
| T |
26386401 |
ggtaatt |
26386407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 303 - 339
Target Start/End: Original strand, 26381553 - 26381589
Alignment:
| Q |
303 |
acactgttctttttatctgtagagctgcataattgat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26381553 |
acactgttctttttatctgtagagctgcataattgat |
26381589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 25781002 - 25780952
Alignment:
| Q |
155 |
ctggagttttgtagggatgatcaaaggttgcagattgttcttatgttgact |
205 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||| || ||||||| |
|
|
| T |
25781002 |
ctggagtttggtagagatgatcaaaggttgaagattgttcgtaagttgact |
25780952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University