View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8152_low_3 (Length: 299)
Name: NF8152_low_3
Description: NF8152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8152_low_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 48286678 - 48286398
Alignment:
| Q |
19 |
tatctgcccatatctgaacactactttgttcaaaacgccacaccatttttgcattacggttcttcacttccaccattgttaccgtgtttgcgtcgagata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48286678 |
tatctgcccatatctgaacactactttgttcaaaacgccacaccatttttgcattacggttcttcacttccaccattgttatcgtgtttgcgtcgagata |
48286579 |
T |
 |
| Q |
119 |
agcaccgtcggattttgtggttatgttgaaacttggaacacggaaggaaccgaggtggaattctggtatggaaggttgatagagaatgtagataactgcg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48286578 |
agcaccgtcggattttgtggttatgttgaaacttggaacacggaaagaaccgaggtggaattctggtatggaaggttggtagagaatgtagataactgcg |
48286479 |
T |
 |
| Q |
219 |
gcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaacataggcgacaataattacgtttc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48286478 |
gcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaaaataggcgacaataattacgtttc |
48286398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University