View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8152_low_4 (Length: 280)
Name: NF8152_low_4
Description: NF8152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8152_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 8437272 - 8437462
Alignment:
| Q |
19 |
gaggtttgtcaaatgccataccataagattatgacga----caagtaatattaaacaaatatggtttttcatggtcagctcttggattattcactagctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8437272 |
gaggtttgtcaaatgccataccataagattat-acgaaaagtaagtaatattaaacaaatatggtttttcatggtcagctcttggattagtcactagctt |
8437370 |
T |
 |
| Q |
115 |
attttaatttcctcttaattatttgcattgatacaattctagttaagtttgatcttgtcaaaatgaaaatataaacatgtacacactataataagc |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437371 |
cttttaatttcctc----ttatttgcattgatacaattctagttaagtttgatcttgtcaaaatgaaaatataaacatgtacacactataataagc |
8437462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 276
Target Start/End: Original strand, 8437481 - 8437515
Alignment:
| Q |
242 |
ttagtgaagtgtgtggagggcagagggcgtatgct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437481 |
ttagtgaagtgtgtggagggcagagggcgtatgct |
8437515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University