View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8153_high_1 (Length: 223)
Name: NF8153_high_1
Description: NF8153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8153_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 44715477 - 44715684
Alignment:
| Q |
1 |
aaaagtggaaagatggaaagctatatagtaggtggcggcggcgtaccttccggtgaacggtgaggaggcaacggccttggggatccatgagaatcagctc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715477 |
aaaaatggaaagatggaaagctatatagtaggtggtggcggcgtaccttccggtgaacggtgaggaggcaacggccttggggatccatgagaatcagctc |
44715576 |
T |
|
| Q |
101 |
atgtaggtcacgagaatcaggtccatatgagtcgacacggaaggcgacttgaccgttgcaatcatagacggtgaaaccatcaccggcaaagaaaagagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715577 |
atgtaggtcacgagaatcaggtccatatgagtcgacacggaaggcgacttgaccgttgcaatcatagacggtgaaaccatcaccggcaaagaaaagagtg |
44715676 |
T |
|
| Q |
201 |
gttttaag |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
44715677 |
gttttaag |
44715684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 36 - 205
Target Start/End: Original strand, 44705544 - 44705713
Alignment:
| Q |
36 |
cggcggcgtaccttccggtgaacggtgaggaggcaacggccttggggatccatgagaatcagctcatgtaggtcacgagaatcaggtccatatgagtcga |
135 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||| || | ||||||||| |||| ||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
44705544 |
cggcggcgtaccttccggcgaacagtgaggagacaacgaccgtcgggatccattagaacaagctcatctaggtcacgagaatcaggtccatatgagtcaa |
44705643 |
T |
|
| Q |
136 |
cacggaaggcgacttgaccgttgcaatcatagacggtgaaaccatcaccggcaaagaaaagagtggtttt |
205 |
Q |
| |
|
| | ||| ||| |||||| | |||||||||||||||||||||| |||| ||||| |||| |||||| |
|
|
| T |
44705644 |
ctctgaaaacgagttgaccatgagaatcatagacggtgaaaccatcgccggagaagaagagagaggtttt |
44705713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University